'

Геномы и эволюция

Понравилась презентация – покажи это...





Слайд 0

Геномы и эволюция М.Гельфанд 20 февраля 2009


Слайд 1

Из записной книжки Дарвина, 1837


Слайд 2

Испорченный телефон


Слайд 3

Испорченный телефон


Слайд 4

Испорченный телефон


Слайд 5

Испорченный телефон


Слайд 6

Эволюция белков / генов


Слайд 7

Эволюция белков / генов


Слайд 8

Эволюция белков / генов


Слайд 9

Эволюция белков / генов


Слайд 10

Эволюция белков / генов


Слайд 11

Эволюция белков / генов


Слайд 12

Филогенетические деревья Идея, по-видимому, Крика Эмануэль Марголиаш (1963) цитохром с (104 аминокислоты). Число замен: лошадь–свинья (3), -тунец (19), -дрожжи (44) первая реализация – Полинг и Цукеркандль Кимура (1977): большинство замен нейтральны


Слайд 13

Примерно первое дерево белков


Слайд 14

Типичное дерево (родопсины)


Слайд 15

Молекулярная палеонтология Реконструированный белок и его свойства


Слайд 16

Эпидемиология (вирусов)


Слайд 17

Устойчивость бактерий к антибиотикам мутации в гене бета-лактамазы, устойчивость к цефотаксиму (цефалоспорин 3-го поколения)


Слайд 18

Эволюция белков за счет перестановок доменов


Слайд 19

Еще об эволюции белков Источники новых последовательностей («строительного материала»): доменные перестановки дупликации захват некодирующих последовательностей Изменение функции (+ изменение регуляции) кристаллины дельта-кристаллин (прицы и рептилии) – аргининосукцинат лиаза зета-кристаллин (нек. группы млекопитающих) – хинон-редуктаза альфа-кристаллин – белок теплового шока эпсилон-кристаллин (птицы) – лактат-дегидрогеназа тау-кристаллин (птицы) – альфа-энолаза s-кристаллин (головоногие) – глутатион-S-трансфераза эта-кристаллин (слоновые землеройки) – альдегид-дегидрогеназа ро-кристаллин (лягушки) – альдо-кето редуктаза антифризы регулярные повторы, источник не важен


Слайд 20

От генов к видам Деревья для разных семейств генов похожи. Эти деревья согласуются со здравым смыслом и с деревьями, которые строят систематики и палеонтологи. Стало быть, используемые эволюционные модели адекватны и их можно использовать для заполнения лакун в палеонтологической летописи и уточнения таксономии. неоднократное возникновение многоклеточности и т.п. переоценка роли морфологических признаков Полеонтологичевская летопись дает калибровку по времени.


Слайд 21

«Принцип Пирсона» консервативно => важно гены регуляторные участки


Слайд 22

Один и тот же ген в нескольких геномах Sty TCGCTCG--CAGCGGAAAGAGGATTACGCCCTTCGCCTGGAGGCTGTGCAGGGGC---GCCGGAGATGGGATGCATAATT Stm TCGCTCG--CAGCGGAAAGAGGATTACGCCCTTCGCCTGGAGGCTGTGCAGGGGC---GCCGGAGATGGGATGCATAATT Sen TCGCTCG--CAGCGGAAAGAGGATTACGCCCTTCGCCTGGAGGCTGTGCAGGGGC---GCCGGAGATGGGATGCATAATT Eco TTGCCCG--TGCCAGACGGCAGATTATCTCCCTGACCTGGTGGTTGCCCAGGAGGAGGGCCGGAAATAGGTTGTATCATT Kpn ----CGG--TGGCGCAGTGCCTGATGGG-CCTCGCCCTGGAGGACGGTCTGGCAT---ATCAGCAAGGGGGTGCGTCATG Ype TTGTTAGAACAGGGGAAAACGGTAAACAGTGTGGCATTAGATGTCGGTTATAGCT-----CCGCCTCTGCTTTTATCGCC * * * * * * * * * * *   Sty AATTATCCTTTAAC----------CATAAATCTGAGCAATA-TATGCTTGGCGGCCAGATTATGGC--ACACTTGTCCGG Stm AATTATCCTTTAAC----------CATAAATCTGAGCAATA-TATGCCTGGCGGCCAGATTATGGC--ACACTTGTCCGG Sen AATTATCCTTTAAC----------CATAAATCTGAGCAATA-TATGCCTGGCGGCCAGATTATGGC--ACACTTGTCCGG Eco ACGTATCCTTATAC----------CTGAAATCTTCGCAAG--TATGCCTGGCCGCGAGATTATGGC--ACACTTGTCCGG Kpn ATTCATCCTTTCGATATCGCGGTGCTGGAACCAGGTGATGAGTATGCCTGGCGGCCAGATTATGGC--ACACTTCCCCAG Ype ATGTTTCAGCAAATAT--------CGGGTACCA-CGCCTGAGCGTTTCCGGCGGGGCAATAGTGGCTTATACTAAGCCCC * ** * * * * *** * ** **** * *** **   Sty TTAACTCTCGTT-CTCAAACAG------GTACGACAGTC--GTGAAAATTCTCGTTGATGAAAATATGCCTTACGCCCGC Stm TTAACTCTCGTT-CTCAAACAG------GTACGACAGTC--GTGAAAATTCTCGTTGATGAAAATATGCCTTACGCCCGC Sen TTAACTCTCGTT-CTCAAACAG------GTACGACAGTC--GTGAAAATTCTCGTTGATGAAAATATGCCTTACGCCCGC Eco TTAACTCTCGT--CTCATACAG------GTAACACAAAC--GTGAAAATCCTTGTTGATGAAAATATGCCTTATGCCCGC Kpn TTAACTCTCGTT-CTCAGACAG------GTACTGAACT---GTGAAAATCCTCGTTGATGAAAATATGCCCTATGCCCGT Ype CTGTTTTTCATCTGTATGGCAGTTCGCTGTCGGAGAGTAAAGTGAAAATTCTGGTTGATGAAAATATGCCGTACGCTGAG * * ** * * *** ** * ******** ** ***************** ** ** 123123123123123123123123123123123123123 Гены консервативнее, чем межгенные области (точнее, особенности эволюции другие)


Слайд 23

rbsD в энтеробактериях Sty AGGGTTACACTGCGGC-CAGCGAAACGTTTCGCTAGTGGAGCAGAAAAATGAAGAAAGGC Sen AGGGTTACACTGCGGC-CAGCGAAACGTTTCGCTAGTGGAGCAGAAAAATGAAGAAAGGC Stm GGGGTTACACTGCGGC-CAGCGAAACGTTTCGCTAGTGGAGCAGAAAAATGAAGAAAGGC Eco AGGATTAAACTGTGGGTCAGCGAAACGTTTCGCTGATGGAGAA-AAAAATGAAAAAAGGC Ype TTTTCTAAACTCCTTGTTAGCGAAACGTTTCGCTCTTGGAGTA-GATCATGAAAAAAGGT ** *** **************** ***** * * ***** *****   Sty ACCGTACTCAACTCTGAAATCTCGTCGGTCATTTCCCGTCTGGGGCATACTGATACTCTG Sen ACCGTACTCAACTCTGAAATCTCGTCGGTCATTTCCCGTCTGGGGCATACTGATACTCTG Stm ACCGTACTCAACTCTGAAATCTCGTCGGTCATTTCCCGTCTGGGGCATACTGATACTCTG Eco ACCGTTCTTAATTCTGATATTTCATCGGTGATCTCCCGTCTGGGACATACCGATACGCTG Ype GTATTACTGAACGCTGATATTTCCGCGGTTATCTCCCGTCTGGGCCATACCGATCAGATT * ** ** **** ** ** **** ** *********** ***** *** *


Слайд 24

rbsD в энтеробактериях Sty AGGGTTACACTGCGGC-CAGCGAAACGTTTCGCTAGTGGAGCAGAAAAATGAAGAAAGGC Sen AGGGTTACACTGCGGC-CAGCGAAACGTTTCGCTAGTGGAGCAGAAAAATGAAGAAAGGC Stm GGGGTTACACTGCGGC-CAGCGAAACGTTTCGCTAGTGGAGCAGAAAAATGAAGAAAGGC Eco AGGATTAAACTGTGGGTCAGCGAAACGTTTCGCTGATGGAGAA-AAAAATGAAAAAAGGC Ype TTTTCTAAACTCCTTGTTAGCGAAACGTTTCGCTCTTGGAGTA-GATCATGAAAAAAGGT ** *** **************** ***** * * ***** *****   Sty ACCGTACTCAACTCTGAAATCTCGTCGGTCATTTCCCGTCTGGGGCATACTGATACTCTG Sen ACCGTACTCAACTCTGAAATCTCGTCGGTCATTTCCCGTCTGGGGCATACTGATACTCTG Stm ACCGTACTCAACTCTGAAATCTCGTCGGTCATTTCCCGTCTGGGGCATACTGATACTCTG Eco ACCGTTCTTAATTCTGATATTTCATCGGTGATCTCCCGTCTGGGACATACCGATACGCTG Ype GTATTACTGAACGCTGATATTTCCGCGGTTATCTCCCGTCTGGGCCATACCGATCAGATT * ** ** **** ** ** **** ** *********** ***** *** *


Слайд 25

FNR, DnaA, NrdR регулируют nrdD


Слайд 26

Эволюция за счет изменений регуляции Лактаза Эксперимент: пересадка регуляторной области гена Prx1 летучей мыши в геном мыши => удлинение передних конечностей на 15%


Слайд 27

Следы эволюционных событий ретровирусы и т.п. (полно)геномные дупликации горизонтальный перенос генов синонимичные замены псевдогены Mycobacterium leprae RbsR в Yersinia pestis слабовредные мутации


Слайд 28

Сайт есть – регулятора нет потеря RbsR у Y. pestis (ABC-транспортер тоже потерялся) Start codon of rbsD RbsR binding site


Слайд 29

Неоднократные потери и возвращения крыльев в ходе эволюции палочников


Слайд 30

Скорость эволюции. Положительный и отрицательный отбор Разные гены эволюционируют с разной скоростью имеющие наибольшее число связей, самые важные (рибосомные белки, гистоны) – медленно это следствие отрицательного отбора (против нового) Положительный отбор: новое – хорошо поверхностные антигены патогенов и иммунная система рецепторы сперматозоидов и яйцеклеток репродуктивная изоляция за счет дрейфа видообразование


Слайд 31

Обезьяна -> человек Изменения регуляции и уровней экспрессии генов Дупликации генов Быстрая эволюция генов (под влиянием положительного отбора)


Слайд 32

Происхождение жизни «Эволюция» как метафора может использоваться при обсуждении любой стадии происхождения жизни но это не очень поучительно Естественный отбор начинается, когда появляются репликаторы (самовоспроизводящиеся структуры) Что можно сказать о LUCA? РНКовый геном неоднократное изобретение (заимствование у вирусов?) аппарата транскрипции и репликации ДНК трансляция (рибосомы, тРНК, аминоацил-тРНК-синтетазы) генетический код что-то о метаболизме был ли он клеткой?? двукратное изобретение клеточных мембран LECA, LBCA, LACA происхождение эукариот


×

HTML:





Ссылка: