
Что такое биоинформатика? Банк SwissProt

Понравилась презентация – покажи это...

Слайд 0

Что такое биоинформатика? Банк SwissProt С.А.Спирин 7, 8,10 февраля 2006 г., ФББ МГУ

Слайд 1

Что такое биоинформатика? Исследование информационных процессов в биологических системах (клетках, органах, организме, популяции). Изучение и внедрение в компьютерную науку «биологических» методов анализа информации (нейросетей, генетических алгоритмов, нечеткой логики и др.). Применение компьютерных методов для решения биологических задач. Телепатия, парапсихология, информационные поля и т.п. ?

Слайд 2

Биоинформатика Исследование информационных процессов в биологических системах (клетках, органах, организме, популяции). Изучение и внедрение в компьютерную науку «биологических» методов анализа информации (нейросетей, генетических алгоритмов, нечеткой логики и др.). Применение компьютерных методов для решения биологических задач. Телепатия, парапсихология, информационные поля и т.п.

Слайд 3

Примеры задач биоинформатики Разработка алгоритмов для анализа большого объема биологических данных Алгоритм поиска генов в геноме Анализ и интерпретация биологических данных таких, как нуклеотидные и аминокислотные последовательности, структура молекул белков, структура комплексов молекул белков с другими молекулами. Изучение структуры активного центра белка Разработка программного обеспечения для управления и быстрого доступа к биологическим данным Создание банка данных аминокислотных последовательностей

Слайд 4

Что понимать под биоинформатикой? Как видим, смысл термина ещё ?же... Применение компьютерных методов для решения биологических задач Применение компьютерных методов для решения задач молекулярной биологии ... и еще ?же... Компьютерный анализ экспериментальных данных о структурах биологических макромолекул (белков и нуклеиновых кислот) с целью получения биологической информации

Слайд 5

Итак... Биоинформатика = вычислительная молекулярная биология Почему так сузился смысл термина?

Слайд 6

gatcctccatatacaacggtatctccacctcaggtttagatctcaacaacggaaccattg ccgacatgagacagttaggtatcgtcgagagttacaagctaaaacgagcagtagtcagct ctgcatctgaagccgctgaagttctactaagggtggataacatcatccgtgcaagaccaa gaaccgccaatagacaacatatgtaacatatttaggatatacctcgaaaataataaaccg ccacactgtcattattataattagaaacagaacgcaaaaattatccactatataattcaa agacgcgaaaaaaaaagaacaacgcgtcatagaacttttggcaattcgcgtcacaaataa attttggcaacttatgtttcctcttcgagcagtactcgagccctgtctcaagaatgtaat aatacccatcgtaggtatggttaaagatagcatctccacaacctcaaagctccttgccga gagtcgccctcctttgtcgagtaattttcacttttcatatgagaacttattttcttattc tttactctcacatcctgtagtgattgacactgcaacagccaccatcactagaagaacaga acaattacttaatagaaaaattatatcttcctcgaaacgatttcctgcttccaacatcta cgtatatcaagaagcattcacttaccatgacacagcttcagatttcattattgctgacag ctactatatcactactccatctagtagtggccacgccctatgaggcatatcctatcggaa aacaataccccccagtggcaagagtcaatgaatcgtttacatttcaaatttccaatgata cctataaatcgtctgtagacaagacagctcaaataacatacaattgcttcgacttaccga gctggctttcgtttgactctagttctagaacgttctcaggtgaaccttcttctgacttac tatctgatgcgaacaccacgttgtatttcaatgtaatactcgagggtacggactctgccg acagcacgtctttgaacaatacataccaatttgttgttacaaaccgtccatccatctcgc tatcgtcagatttcaatctattggcgttgttaaaaaactatggttatactaacggcaaaa acgctctgaaactagatcctaatgaagtcttcaacgtgacttttgaccgttcaatgttca ctaacgaagaatccattgtgtcgtattacggacgttctcagttgtataatgcgccgttac ccaattggctgttcttcgattctggcgagttgaagtttactgggacggcaccggtgataa actcggcgattgctccagaaacaagctacagttttgtcatcatcgctacagacattgaag gattttctgccgttgaggtagaattcgaattagtcatcggggctcaccagttaactacct ctattcaaaatagtttgataatcaacgttactgacacaggtaacgtttcatatgacttac ctctaaactatgtttatctcgatgacgatcctatttcttctgataaattgggttctataa

Слайд 7

В конце 1970-х годов был изобретён относительно быстрый и дешёвый метод экспериментального определения последовательности оснований в ДНК Организм ДНК «в пробирке» Последовательность выделение секвенирование ...TGCCACAAATCAC...

Слайд 8

Для хранения все возрастающей информации о последовательностях ДНК в 1982 году был основан GenBank GenBank — хранилище последовательностей нуклеиновых кислот в виде компьютерных файлов Объем GenBank’а: 1982: 680 338 букв в 606 последовательностях 1992: 101 008 486 букв в 78 608 последовательностях 2002: 28 507 990 166 букв в 22 318 883 последовательностях 2004: 44 575 745 176 букв в 40 604 319 последовательностях 2005: 56 037 734 462 букв в 52 016 762 последовательностях (из ~165 000 организмов) Размер файлов — 196 Gb

Слайд 9

Пионеры биоинформатики Лайнус Полинг 1962 Zuckerkandl, E., and L. Pauling. 1962. Molecular disease, evolution, and genic heterogeneity. Horizons in Biochemistry, Academic Press, New York, 189-225. Zuckerkandl, E., and L. Pauling. 1965. Evolutionary divergence and convergence in proteins. Evolving Genes and Proteins, Academic Press, New York, 97-166. Анализ аминокислотных последовательностей глобинов нескольких позвоночных Гипотеза молекулярных часов

Слайд 10

Пионеры биоинформатики Маргарет Дейхофф Однобуквенный код аминокислот A,C,D,E,F,G,H… Матрицы аминокислотных замен PAM (Point Accepted Mutation) 1965 Атлас последовательностей белков и их структур (1965)

Слайд 11

Первый “банк данных” Атлас белковых последовательностей и их структур 1965 -1978 Первая версия атласа содержала описание 65 (!) последовательностей белков

Слайд 12

Банки данных Архивные (примеры: PDB, GenBank) за содержание каждой записи отвечает её автор-экспериментатор Курируемые за содержание записей отвечают специальные люди — кураторы Автоматические записи генерируются компьютерными программами

Слайд 13

Банк данных Swiss-Prot 1986 Swiss-Prot – база знаний о белковых последовательностях http://www.expasy.org/sprot/ Курируемая база данных “Золотой стандарт” аннотации

Слайд 14

Банк данных Swiss-Prot Амос Байрох Руководитель группы Swiss-Prot в Швейцарском Институте Биоинформатики С 1987 поддерживается в сотрудничестве между Swiss Institute of Bioinformatics (SIB) European Bioinformatics Institute (EBI)

Слайд 15

Банк данных Swiss-Prot Статистика роста количества документов Текущий релиз 48.9 (24 января 2006) содержит 206586 документов 1986 2006 2001

Слайд 16

Банк данных TrEMBL Формальная трансляция всех кодирующих нуклеотидных последовательностей из банка EMBL Автоматическая классификация и аннотация TrEMBL (Translated EMBL) Текущий релиз 31.9 (24 января 2006) содержит 2 586 884 документа

Слайд 17

Тенденция объединения 2002

Слайд 18

Банк данных UniProt UniProt (Universal Protein Resource) UniProt Knowlegebase – SwissProt+TrEMBL UniProt Archive – UniParc UniProt Reference – UniRef

Слайд 19

~2 500 000 последовательностей компьютерный поиск гена, трансляция и компьютерная аннотация UniRef (UniProt non-redundant Reference databases) UniParc (UniProt Archive) ?200 000 последовательностей Экспертиза Базы данных научной литературы

Слайд 20

Соотношение числа белков, представленных в разных банках 3 078 524 33 321 206 586 Последовательностей во много раз больше, чем структур! Большинство последовательностей не аннотированы!

Слайд 21

Документ банка данных Swiss-Prot Описание документа: идентификатор, имя, дата создания и модификации Аннотация последовательности Последовательность

Слайд 22

Основные поля записи SwissProt ID AC DE OS OC И сама последовательность, конечно.


