'

Наша группа была организована в 1998 году (сектор, затем лаборатория)

Понравилась презентация – покажи это...





Слайд 0

Наша группа была организована в 1998 году (сектор, затем лаборатория)


Слайд 1

Сотрудники: д.ф.-м.н. П.В. Голубцов (МГУ), к.ф.-м.н. А.Г. Витрещак, д.ф.-м.н. В.Г. Кановей,  д.ф.-м.н. В.А. Любецкий,  к.ф.-м.н. К.Ю. Горбунов, к.ф.-м.н. А.В. Селиверстов, к.ф.-м.н. Е.В. Любецкая, к.б.н. Л.Ю. Русин, к.б.н. Е.А. Лысенко (ИФР),  О.А. Зверков,  К.В. Лопатовская Студенты ФББ: М. Баранова, А. Рогов, И. Глотова Студенты/аспиранты мех-мата: Д. Колобков, А. Шатравин, И. Иванов, М. Секирко, Е. Хмуркин Бывшие аспиранты: Л. Данилова, Л. Леонтьев, М. Ширшин, А. Армизонов Тесно сотрудничали/чаем с: В.В. Вьюгиным, М.С. Гельфандом, А.А. Мироновым, С.А. Пироговым, В.В. Алешиным (МГУ), Е.А. Асариным, Е.А. Жижиной, Л.И. Рубановым


Слайд 2

С 2000 года нами опубликовано: 2 монографии и 1 вузовский учебник (то и другое по математике) и 23 статьи в математических журналах (Успехи мат. наук, Труды института им. Стеклова, Мат. Заметки и т.д.) А также – опубликовано 36 статей в биологических журналах (Молекулярная биология, Биофизика, Биохимия, FEMC, ВМС, JBCB, inSB, ...) (без ИП и трудов конференций) сайт http://lab6.iitp.ru Подготовлено 2 докторские и 3 кандидатские диссертации (все – физ.-мат. науки, «теоретические основы информатики», «биоинформатика»).


Слайд 3

Ежегодно делаем доклады примерно на 4-х международных конференциях (поровну математических и биологических). За это время сотрудники приняли участие в выполнении: 25 грантов, 2 целевых грантов, 2 научных программ и 2 совместных тем по линии РАН-СНРС. Сейчас я – руководитель грантов РФФИ, МНТЦ и темы по РАН-СНРС. Лауреат премии «За лучшую публикацию в журнале Молекулярная биология» за 2005 год.


Слайд 4

Тесно сотрудничаем с кафедрой «математической логики и теории алгоритмов» мех-мата МГУ, в частности, я читаю там курс «Модели и алгоритмы в биоинформатике». Другие сотрудники лаборатории также преподают в МГУ и в Государственной классической академии.


Слайд 5

Проблемы эффективности (это – дескриптивная теория множеств, нестандартный анализ, теория алгоритмов, пучки на алгебрах; динамические игры), (Любецкий, Кановей, Горбунов, Селиверстов, Голубцов, ...) 2) Модели (и алгоритмы) основных молекулярных процессов в клетке: геномы бактерий, геномы, пластидные (хлоропластные) и ядерные, растений, водорослей и простейших, .....


Слайд 6

Модели и алгоритмы (компьютерный счет) Биологические данные Биологический результат


Слайд 7

ген 1 ген 2 ген 3 ДНК=геном – последовательность в 4х-буквенном алфавите {A,C,T,G} с характерной длиной 3 миллиона – 6 миллиардов (и меньше) позиций. Каждая буква называется «нуклеотид». инструкция для химической реакции – создается фермент; или для создания другой молекулы: белка или РНК сигнал 2 сигнал 3 лидерная область 2 лидерная область 3 Ген считывается! по сигналу из лидерной области инструкция для химической реакции 2 инструкция для химической реакции 3


Слайд 8

Существует несколько типов сигналов (= регуляций): М.С. рассказывал об одном типе сигнала (это сигнал показан ниже), я расскажу о двух других типах сигналов Сигнал типа «репрессия/активация» связанный с «ПЕРВИЧНОЙ структурой» ДНК. На следующем слайде показан сигнал другого типа связанный с «ВТОРИЧНОЙ структурой» ДНК (=мРНК)


Слайд 9

Показана лидерная область перед геном, в ней «окно» с концами x и y, а в окне образуются «спирали»; и множество спиралей как раз называется ВТОРИЧНОЙ структурой в окне ген левое плечо правое плечо x y


Слайд 10

«Спираль» с «плечами», склеиваются G с C и A с T:


Слайд 11

Реальные еще очень простые вторичные структуры:


Слайд 12

T A лидерная область Два сигнала (состояния). Результат определяется тем, какая из двух альтернативных вторичных структур образуется: «Т» – тогда «терминация» или «А» – тогда «антитерминация»


Слайд 13

Переходы, возможные для этой регуляции и соответственно в нашей модели: (1) Правый конец y окна сдвигается на один нуклеотид вправо или остается на месте или подается сигнал «Т». Альтернатива: когда правый конец y доходит до начала гена, то подается сигнал «А». При этом вторичная структура в окне формирует выбор между Т или А; (2) Левый конец x окна сдвигается на три нуклеотида вправо или остается на месте, что зависит от частоты c предшествующего считывания регулируемого гена; (3) Вторичная структура преобразуется в окне, т.e. текущая вторичная структура ? трансформируется в новую структуру ?'.


Слайд 14

Ищется p(c) – частота наступления состояния «Т» («несчитывания гена» = состояния терминации), при каждом фиксированном значении частоты считывания («концентрации») c.


Слайд 15

Результат нашей модели для случая регуляции биосинтеза триптофана у Vibrio cholerae (gamma subdivision):


Слайд 16

Примеры результатов счета в этой модели Мы считали функцию p=p(c) для практически всех лидерных областей аминокислотных оперонов и аминоацил-тРНК синтетаз. Имеется высокое согласие с экспериментом, с одной стороны, и предсказание многих новых случаев такой регуляции, с другой стороны. Здесь показаны thrA опероны у гамма-протеобактерий.


Слайд 17

Два основных направления нашей работы в Биоинформатике: Модели регуляции генов: 1a) тип регуляции/сигнала – «с вторичной структурой» – уже рассказано; 1b) тип регуляции/сигнала – «промотор» – вторая очередь; Модели эволюции этих регуляций/сигналов, т.е. эволюции регуляций 1а – будет сейчас; 1b – вторая очередь.


Слайд 18

Два основных направления нашей работы в Биоинформатике: 1а) тип сигнала – «вторичная структура»: [Lyubetsky, Pirogov, Rubanov, Seliverstov, 2007, Journal of Bioinformatics and Computational Biology, vol 5, no 1, p. 155-180], 1b) тип сигнала – «промотор»: [Селиверстов, Лысенко, Любецкий, 2009, Физиология растений РАН, том 56, № 5; Seliverstov, Rubanov, Lyubetsky ВМС Evol Biol, представлена] 2) Модели эволюции этих регуляций, т.е. эволюции сигналов 1а и 1b: [Любецкий, Жижина, Рубанов, 2008, Гиббсовский подход в задаче эволюции регуляторного сигнала экспрессии гена, ППИ, №4; Горбунов, Любецкий МолБио, представлена]


Слайд 19

Дано дерево G , у которого длины ребер соответствуют времени переходу от предка к потомку: Ищем все предковые последовательности Еще даны современные последовательности


Слайд 20

Иногда ищется и само дерево : тогда даны только современные последовательности. Эти заданные последовательности – виды, гены, белки, сигналы. «Обусловленность» решения? Мы рассмотрим именно случай сигнала с вторичной структурой (т.е. сигнала типа 1а).


Слайд 21

Классическая аттенюаторная регуляция биосинтеза треонина у гамма-протеобактерий VC = Vibrio cholerae, VV = Vibrio vulnificus, VP = Vibrio parahaemolyticus, AB = Actinobacillus actinomycetemcomitans, HI = Haemophylus influenzae, PQ = Mannheimia haemolytica, VK = Pasterella multocida, YP = Yersinia pestis, EO = Erwinia carotovora, TY = Salmonella typhi , XCA = Xanthomonas campestris, EC = Escherichia coli, KP = Klebsiella pneumoniae, SON = Shewanella oneidensis ?конфигурация ?


Слайд 22

Наша модель эволюции сигнала: Такая функция минимизируется с помощью алгоритма аннилинга. На каждом его шаге текущая конфигурация заменяется на новую из определенного списка возможностей с вероятностью или остается прежней с вероятностью . Нами доказана сходимость к глобальному min при условии


Слайд 23

?j ?'j Показано одно ребро от некоторой конфигурации ?. На этом ребре за время tj происходят: замены букв со скоростями R, вставки букв и делеции букв. tj Сначала выравниваем позиции у ?j и ?'j, при этом возникают пустые позиции. Длины участков с пустыми позициями обозначим ljm. Тогда: Слагаемое H1(?) в функции H j-е ребро


Слайд 24

hj h'j Показано одно ребро от конфигурации ?. На этом ребре произошел переход от вторичной структуры hj в ?j к вторичной структуре h'j в ?'j. Тогда: Слагаемое H2(?) в функции H j-е ребро ?j ?'j


Слайд 25

Решение (фрагмент): эволюция предкового сигнала


Слайд 26

Поиск и эволюция сигнала другого типа (1b): промотора гена Мы искали промоторы (РЕР) в пластомах всех растений и водорослей перед всеми белок-кодирующими генами. -35бокс: TTGaca ...17-18н...-10бокс: TAtaaT стр. ген


Слайд 27

Итак, промотор – некоторая комбинация слов (= боксов) с условиями на них: Промотор состоит, по крайней мере, из двух боксов длины 6 каждое с расстоянием между ними около 17-18 букв. Известны: некоторое нечеткое предпочтение определенных букв в определенных позициях, дополнительные боксы, кривизна, распределение потенциала (у бактерий). Такая комбинация слов и расстояний называется многобоксовым сигналом. Это описание недостаточно четкое, поэтому нужно множественное выравнивание.


Слайд 28

«Считывание» гена состоит из двух этапов: транскрипции и трансляции. Первый этап начинается со связывания комплекса молекул (РНК-полимеразы + сигма-субъединицы) с ДНК. Связывание происходит со специальным местом на ДНК, которой называется промотором. Это место – целая структура, которая может состоять из двух боксов: «-35 бокса» и «-10 бокса» и еще из «TG-расширения -10 бокса». Роль промотора гена


Слайд 29

TTGACATGGCT=ATATAAGTCATGTTATACT Arabidop TTGACACGGG=CATATAAGGCATGTTATACT...ASpinacia TTCACGATA==TATATAAGTCATACTATACT Cycas TTGACATACA=GATATGTCTCATATTATACT Cryptomer TTGACATTGAT=ACATGGATCATATTATACT Pinus TTGACTTTAAT=AAACCATTTCTGTTATACT Welwitsch TTGACACGGAT=AGGTTTTT=GTGATATGCT Adiantum TTGACATCAAT=AGATAAGTTGTGTTATACT Angiopter TTGACATATAT=GGAAAGATCATGTTATACT Psilotum TTGACACAAA=AAGAAAGATTGTGTAATATT Huperzia TTGACATAC=TAATGGGATATGTGTAATAAT Aneura TTGACATAA=TCATATGTTATGTGTAATACT Marchantia TTGACATAA=TAATACATTTTGTGTAATACT Physcomitr TTGACATTT=TTATACTTTACATACTATAAT Chara TTGACATTAGTTATACGT=TTGTGCAATACT Chaetospha TTGACAGCT=TAAGGTTAAT=ATGTAATAAT Staurastr TTGACAACAG=CATTAACTATCTGTAATAAT Zygnema TTGACAAATA=AACATCATTT=TGGCATAAT Mesostig TTGATTAATATAA=ATTAATTA=GTTATAAT Bigelowiel


Слайд 30

Для гена psbA (photosystem II protein D1) в пластомах эукариот найден древний промотор с консенсусом TTGACA-15-TGTwATAmT, восходящий по крайней мере к предку Streptophyta или даже к Viridiplantae


Слайд 31

Столь же древние промоторы нами найдены и перед другими генами, например: psbB, psbE, rbcL, psaA у почти всех Streptophytina, а для гена rps20 – у всех красных и криптофитовых водорослей. С другой стороны, определена эволюция (не древних) промоторов для генов, например: psbN – у всех цветковых растений и у голосеменного Cycas; а для гена ndhF у всех цветковых растений. Таким образом, промоторы, как и гены, иногда очень консервативны, а иногда испытывают быструю эволюцию – пример биологического результат.


Слайд 32


Слайд 33

Для поиска промоторов (и вообще многобоксовых сигналов) использовались два алгоритма, которые как и все наши основные алгоритмы доступны: http://lab6.iitp.ru Один из них описан ниже – поиск многобоксовых сигналов, другой – множественное выравнивание по филогенетическому дереву. Далее излагается первый из этих алгоритмов для случая однобоксового сигнала:


Слайд 34

Даны n последовательностей. Задача: найти систему сигналов (=мотив) s = {s1,...,sk}, состоящую из сигналов (=участков) s1,...,sk, где k ? n. Все участки имеют одинаковую длину. Определяем качество системы как сумму попарных близостей сигналов, составляющих систему. Leader region 1 Leader region n


Слайд 35

Ищем систему с максимальным значением качества, т.е. ищем максимум целевого функционала F в пространстве всех возможных систем:


Слайд 36

Идея нашего алгоритма. Делим все последовательности на две примерно равные части и лучшую систему в одной части объединяем с лучшей системой в другой части. Пусть ?1(?) – лучшая система в одной части как функция от ? (и фиксирована последовательность *), а ?2(?) – аналогичная система в другой части как функция от ? . Индуктивный шаг: от ?1(•) и ?2(•) переходим к ?(•) по правилу: ? лучшая система ?1(?)+?2(?), полученная пере-бором всех ? и ? в *последователь-ностях Lead. reg. n Lead. reg. 1


Слайд 37

Пример. Даны n=14 последовательностей, каждая с длиной m=201; ищем систему сигналов с длиной 15.


Слайд 38

Работа алгоритма:


Слайд 39

Результат работы алгоритма:


Слайд 40

Качество потенциального сигнала растет в процессе счета: Quality Iteration


Слайд 41

Последовательное изменение качества сигнала в ходе алгоритма: Quality Iteration


Слайд 42

Параллельная реализация вычислительно трудоемких алгоритмов: поиск мультибоксового регуляторного сигнала в группе геномов «Однобоксовый» сигнал: - полный перебор O(mn) наш алгоритм O(n2m3) «Двухбоксовый» сигнал: - полный перебор O(mndn) наш алгоритм O(n2m3d3) (n – число последовательностей, m – максимальная длина, d – интервал расстояний между боксами сигнала) Волновая вычислительная схема на двумерной ?-сети перестановок мощностью порядка n2 (в полном пространстве n! перестановок): отсутствует жёсткая привязка к числу процессоров кластера линейный рост производительности от числа доступных процессоров в широком диапазоне (проверено на МВС-1000М МСЦ, до 512 CPU) Пример для n=45, m=201, 8 CPU


Слайд 43

Wavelike computation scheme Using 2D queue of permutations (P,Q) instead of straight one ?Q7,8(77) 193.0 ===== ?Q5,8(72) 264.4 ?Q4,8(73) 184.4 ?Q2,8(78) 234.2 ?Q0,8(74) 202.7 ?Q7,7(69) 198.0 ?Q6,7(71) 274.0 ?Q5,7(64) 279.2 ?Q4,7(65) 206.5 ?Q2,7(70) 267.6 ===== ?Q0,7(67) 274.0 n=45, m=201, l=15, 8 CPU’s ?Q7,6(62) 190.0 ?Q6,6(61) 275.1 ?Q5,6(56) 287.9 ?Q4,6(57) 196.2 ===== ?Q2,6(63) 266.0 ?Q1,6(60) 249.6 ?Q0,6(58) 292.0 ?Q7,2(29) 204.5 ?Q6,2(30) 254.5 ?Q5,2(24) 273.6 ?Q4,2(25) 195.5 ?Q3,2(28) 202.8 ?Q2,2(31) 195.7 ?Q1,2(27) 239.1 ?Q0,2(26) 190.3 ?Q8,1(76) 204.5 ?Q7,1(23) 191.0 ?Q6,1(20) 287.0 ?Q5,1(16) 274.0 ?Q4,1(17) 213.3 ?Q3,1(21) 217.8 ?Q2,1(22) 212.5 ?Q1,1(19) 250.1 ?Q0,1(18) 178.6 ?Q9,0(75) 260.7 ?Q8,0(66) 207.7 ?Q7,0(15) 227.7 ?Q6,0(9) 267.2 ?Q5,0(10) 276.1 ?Q4,0(8) 189.7 ?Q3,0(13) 211.6 ?Q2,0(14) 244.9 ?Q1,0(12) 242.1 ?Q0,0(11) 226.6 P9(68) ? 184.2 P8(59) ? 218.7 P7(7) ? 207.7 P6(6) ? 197.6 P5(5) ? 198.8 P4(4) ? 211.7 P3(3) ? 260.6 P2(2) ? 201.6 P1(1) ? 206.0 P0(0) ? 175.8 260.6 250.1 287.0 292.0 P10(79) ?… 214.2


Слайд 44

Параллельная реализация вычислительно трудоемких алгоритмов: реконструкция эволюции регуляторного сигнала в группе геномов Усовершенствованная параллельная схема аннилинга MC3 (= Metropolis-Coupled Markov Chain Monte-Carlo): лучшее покрытие множества минимальных конфигураций меньшая зависимость от выбранной начальной точки более быстрая сходимость к одному из предполагаемых абсолютных минимумов функционала «энергии» Индивидуальные режимы охлаждения Периодический обмен параметрами охлаждения между находящимися в окрестности различных локальных или условных минимумов цепями с разной температурой способствует выходу из оврагов и локальных минимумов поверхности отклика.


Слайд 45

Тема – связь (РЕР) промоторов и предпочитаемых ими сигма-субъединиц. Например, нами показано, что промотор С предпочтительно связывает Sig4-субъединицу РНК-полимеразы. Аналогично для фаговых промоторов и полимераз.


Слайд 46

Наши биологические результаты 1. Проведена реконструкция эволюционных событий молекулярного уровня: построены деревья белков и согласующие их деревья видов, найдены события потенциальных горизонтальных переносов, потерь и дупликаций генов, случаи массовой дупликации генов в предковом геноме, статистические характеристики эволюционных событий по вершинам дерева видов и по таксономическим группам, сравнивались сценарии горизонтальных переносов против дупликаций и потерь генов. [In the book: Bioinformatics of Genome Regulation and Structure II. Springer Science & Business Media, Inc. 2005]


Слайд 47

2. Предложены новые типы регуляции экспрессии генов: 2.1 Регуляция на уровне трансляции, опосредован-ная Т-боксом, например, гена ileS, кодирующего изолейцил-тРНК синтетазу, у Актинобактерий. [BMC Microbiology, 2005, 5:54; Молекулярная биология, 2005, 39(6)] 2.2 Регуляция на уровне трансляции посредством взаимодействия рибосомы, транслирующей лидерный пептид, и вторичной структуры РНК для гена leuA, кодирующего 2-изопропилмалатсинтазу, у Актинобактерий («LEU-элемент»). [BMC Microbiology, 2005, 5:54; Молекулярная биология, 2005, 39(6)]


Слайд 48

2.3 Сложные типы классической аттенюаторной регуляции (когда антитерминатор не альтернативен терминатору), например, у лактобацилл перед геном ilvD: это – цепь спиралей или псевдоузел. [готовится к печати] 2.4 Аттенюаторная регуляция генов cysK синтеза цистеина у Актинобактерий, вовлекающая ро-белок для терминации транскрипции: рибосома, транслирующая лидерный пептид, перекрывает сайт связывания ро-белка. [BMC Microbiology, 2005, 5:54] 2.5 Регуляция гена leuA у альфа-протеобактерий, вовлекающая ген лидерного пептида и консервативный псевдоузел («LEU1-регуляция»). [готовится к печати]


Слайд 49

2.6 Регуляция, опосредованная аномально длинной спиралью РНК, генов, кодирующих транспортёры двухвалентных катионов (mntH) и ферменты, зависимые от металлов (никель-зависимая глиоксалаза и др.), у бруцелл. Выясняется роль этой регуляции в выживании бруцеллы при незавершённом фагоцитозе (бруцеллез). [Биофизика, в печати] 2.7 Статистические данные о расположении длинных спиралей в геномах Актинобактерий относительно кодирующих областей: длинные спирали концентрируются в некодирующих областях вблизи 3'-концов высоко экспрессируемых генов (включая тРНК) или между сходящимися навстречу друг другу генами. Выясняется роль таких шпилек в снятии конформационного напряжения ДНК и при терминации транскрипции путем образования крест-шпилек на ДНК. [МолБиол, 2007, 41(4)]


Слайд 50

3. Найдены новые случаи известных типов регуляции у бактерий: 3.1 Предсказана белок-ДНКовая регуляция на уровне транскрипции и также промоторы генов синтеза пролина у протеобактерий родов Pseudomonas и Shewanella. [Молекулярная биология, 2007, 41(3)] 3.2 Предсказано много случаев белок-ДНКовой репрессии/активации. В частности, охарактеризован GlpR-регулон (регуляция метаболизма глицерол-3-фосфата). [Молекулярная биология, 2003, 37(5) – совместно с М.С. и его сотрудниками].


Слайд 51

3.3 Проведен широкомасштабный поиск регуляции на уровне транскрипции посредством Т-боксов. [Молекулярная биология, 2005, 39(6)] 3.4 Предсказана классическая аттенюаторная регуляция: (a) у протеобактерий (включая дельта-протеобактерии) и у видов из таксономических групп бацилл/клостридий и бактероидов [FEMS 2004], (b) у Актинобактерий [BMC Microbiology, 2005, 5:54]


Слайд 52

3.5 Предсказана регуляция на уровне трансляции посредством тиаминового рибопереключателя для гена ykoE, кодирующего субъединицу ABC транспортёра: происходит перекрывание сайта связывания рибосомы иногда прямо черенком рибопереключателя, а иногда дополнительной спиралью РНК – происходит быстрая смена этих механизмов регуляции у очень близких видов (показана эволюция этого механизма). [Информационные процессы, 2006, 6 (1)]


Слайд 53

4. Белок-РНКовая регуляция в пластидах: 4.1 Корреляция сплайсинга с белок-РНКовой регуляцией трансляции в хлоропластах растений и водорослей. [Journal of Bioinformatics and Computational Biology, 2006, 4, 4, 783; Биофизика, 2006, 51, тематический выпуск 1] 4.2 Связь вторичной структуры РНК с редактированием инициирующего кодона в хлоропластах у мхов и папоротников. [Биофизика, 2006, 51, тематический выпуск 1] 4.3 Найдена высоко консервативная регуляция экспрессии генов psaA, psbA и psbB (вне связи со сплайсингом) [Journal of Bioinformatics and Computational Biology, 2006, 4(4)].


Слайд 54

4.4 Найдена ортологичная консервативная регуляция гена ycf24 на уровне трансляции в пластидах красных водорослей и паразитов из таксона Apicomplexa (Eimeria tenella, Plasmodium spp., Toxoplasma gondii). Более того, у T. gondii эта регуляция охватывает и много других генов, включая те, которые кодируют РНК-полимеразу: этот ген кодирует белок SufB, необходимый для формирования железосероцентров. Выясняется роль пластид в жизни токсоплазм на молекулярном уровне. [Мол. биология, в печати]


Слайд 55

5. Промоторы бактериального типа в пластидах и соответствующие им сигма-факторы у растений и водорослей: 5.1 Изучена быстрая эволюция промоторов перед геном ndhF, чья транскрипция у Резушки Таля (Arabidopsis thaliana) существенно зависит от сигма-субъединицы Sig4. [Физиология растений, в печати]. 5.2 Предсказано, что кодируемая в ядре сигма-субъединица Sig4 РНК-полимеразы бактериального типа существовала уже у предка высших двудольных растений и у него же имелся Sig4-зависимый промотор: соответствующие кДНК sig4 найдены по базе EST у винограда Vitis vinifera и двух видов апельсина Citrus clementina и C. sinensis (у апельсинов это псевдоген). Также известен псевдоген sig4 у тополя Populus trichocarpa. А Sig4-зависимые промоторы предсказаны в хлоропластах у всех видов из таксона Eurosids II (включая крестоцветные, апельсин и хлопок), а также у нескольких далёких представителей двудольных: эвкалипта, винограда и платана.


Слайд 56

5.3 Исследованы Sig3-зависимые промоторы перед геном psbN у семенных растений и показано общее! для всех однодольных растений значительное отличие области этого промотора от прочих цветковых растений.


Слайд 57

5.4 Найдены высоко консервативные хлоропластные промоторы бактериального типа перед генами rbcL, psaA, psbA, psbB, psbE у большинства видов из Streptophyta. Более того, промотор перед геном psbA, кодирующим белок D1 второй фотосистемы, одинаков у Streptophyta, включая рано отделившиеся роды Mesostigma и Chlorocybus, и у вторичного симбионта Bigelowiella natans из таксона Cercozoa.


Слайд 58

5.5 Найдены промоторы перед геном rps20 и близлежащие сайты связывания транскрипционного фактора (– ортолога NtcA) в хлоропластах красных и криптофитовых водорослей. При этом сайт для NtcA найден тогда и только тогда, когда дивиргентно располагается ген glnB. У цианобактерий оба белка NtcA и GlnB вовлечены в регуляцию генов метаболизма азота и их взаимная регуляция показана (в частности, NtcA активирует транскрипцию glnB). На этом основании предсказана регуляция в хлоропластах по механизму конкуренции РНК-полимераз, транскрибирующих гены на противоположных цепях ДНК, причем также происходит активация транскрипции glnB.


Слайд 59

6. Найдена общая белок-ДНКовая регуляция экспрессии ядерных генов, кодирующих рубредоксин и киназу, фосфорилирующую белки по тирозину, у диатомовой водоросли Thalassiosira pseudonana и у паразитов родов Theileria и Babesia


Слайд 60

Эти виды являются вторичными симбионтами и имеют пластиды с общим происхождением от красных водорослей. Однако их ядерные геномы сильно отличаются. Поэтому можно предполагать связь этой регуляции с пластидами. Интересно, что киназы обычно участвуют в регуляторных каскадах, передающих сигнал от некоторой мембраны, в частности, от пластиды. Пластиды у диатомовых водорослей и паразитов Apicomplexa похожи, а ядерные геномы значительно различаются. С другой стороны, у криптофитовых водорослей рубредоксин кодируется в нуклеоморфе, т.е. непосредственно связан с пластидами. Поэтому можно предположить, что эти очень близкие регуляторные механизмы связаны с появлением пластид.


×

HTML:





Ссылка: