'

Нуклеотидные последовательности (номенклатура, правила записи и чтения)

Понравилась презентация – покажи это...





Слайд 0

gtcactaaatactttaaccaatataggcatagcgcacagacagataaaaattacagagtacacaacatccatgaaacgcattagcaccaccattaccaccaccatcaccattacca gcttttcattctgactgcaacgggcaatatgtctctgtgtggattaaaaaaagagtgtctgatagcagcttctgaactggttacctgccgtgagtaaattaaaattttattgactta ggtcactaaatactttaaccaatataggcatagcgcacagacagataaaaattacagagtacacaacatccatgaaacgcattagcaccaccattaccaccaccatcaccattacca acggtgcgggctgacgcgtacaggaaacacagaaaaaagcccgcacctgacagtgcgggctttttttttcgaccaaaggtaacgaggtaacaaccatgcgagtgttgaagttcggca aattgaaaactttcgtcgatcaggaatttgcccaaataaaacatgtcctgcatggcattagtttgttggggcagtgcccggatagcatcaacgctgcgctgatttgccgtggcgaga tgtcgatcgccattatggccggcgtattagaagcgcgcggtcacaacgttactgttatcgatccggtcgaaaaactgctggcagtggggcattacctcgaatctaccgtcgatattg agtccacccgccgtattgcggcaagccgcattccggctgatcacatggtgctgatggcaggtttcaccgccggtaatgaaaaaggcgaactggtggtgcttggacgcaacggttccg actctgctgcggtgctggctgcctgtttacgcgccgattgttgcgagatttggacggacgttgacggggtctatacctgcgacccgcgtcaggtgcccgatgcgaggttgttgaagt tgtcctaccaggaagcgatggagctttcctacttcggcgctaaagttcttcacccccgcaccattacccccatcgcccagttccagatcccttgcctgattaaaaataccggaaatc aagcaccaggtacgctcattggtgccagccgtgatgaagacgaattaccggtcaagggcatttccaatctgaataacatggcaatgttcagcgtttctggtccggggatgaaaggga tcggcatggcggcgcgcgtctttgcagcgatgtcacgcgcccgtatttccgtggtgctgattacgcaatcatcttccgaatacagcatcagtttctgcgttccacaaagcgacttgc gagctgaacgggcaatgcaggaagagttctacctggaactgaaagaaggcttactggagccgctggcagtgacggaacggctggccattatctcggtggtaggtgatggtagcacct tgcgtgggatctcggcgaaattctttgccgcactggcccgcgccaatatcaacattgtcgccattgctcagggatcttctgaacgctcaatctctgtcgtggtaaataacgatgatg ccactggcgtgcgcgttactcatcagatgctgttcaataccgatcaggttatcgaagtgtttgtgattggcgtcggtggcgttggcggtgcgctgctggagcaactgaagcgtcagc gctggctgaagaataaacatatcgacttacgtgtctgcggtgttgccaactcgaaggctctgctcaccaatgtacatggccttaatctggaaaactggcaggaagaactggcgcaag aagagccgtttaatctcgggcgcttaattcgcctcgtgaaagaatatcatctgctgaacccggtcattgttgactgcacttccagccaggcagtggcggatcaatatgccgacttgc gcgaaggtttccacgttgtcacgccgaacaaaaaggccaacacctcgtcgatggattactaccatcagttgcgttatgcggcggaaaaatcgcggcgtaaattcctctatgacacca ttggggctggattaccggttattgagaacctgcaaaatctgctcaatgcaggtgatgaattgatgaagttctccggcattctttctggttcgctttcttatatcttcggcaagttag aaggcatgagtttctccgaggcgaccacgctggcgcgggaaatgggttataccgaaccggacccgcgagatgatctttctggtatggatgtggcgcgtaaactattgattctcgctс aaacgggacgtgaactggagctggcggatattgaaattgaacctgtgctgcccgcagagtttaacgccgagggtgatgttgccgcttttatggcgaatctgtcacaactcgacgatc ttgccgcgcgcgtggcgaaggcccgtgatgaaggaaaagttttgcgctatgttggcaatattgatgaagatggcgtctgccgcgtgaagattgccgaagtggatggtaatgatccgc tcaaagtgaaaaatggcgaaaacgccctggccttctatagccactattatcagccgctgccgttggtactgcgcggatatggtgcgggcaatgacgttacagctgccggtgtctttg atctgctacgtaccctctcatggaagttaggagtctgacatggttaaagtttatgccccggcttccagtgccaatatgagcgtcgggtttgatgtgctcggggcggcggtgacacct gatggtgcattgctcggagatgtagtcacggttgaggcggcagagacattcagtctcaacaacctcggacgctttgccgataagctgccgtcagaaccacgggaaaatatcgtttat tgctgggagcgtttttgccaggaactgggtaagcaaattccagtggcgatgaccctggaaaagaatatgccgatcggttcgggcttaggctccagtgcctgttcggtggtcgcggcg atggcgatgaatgaacactgcggcaagccgcttaatgacactcgtttgctggctttgatgggcgagctggaaggccgtatctccggcagcattcattacgacaacgtggcaccgtgt ctcggtggtatgcagttgatgatcgaagaaaacgacatcatcagccagcaagtgccagggtttgatgagtggctgtgggtgctggcgtatccggggattaaagtctcgacggcagaa agggctattttaccggcgcagtatcgccgccaggattgcattgcgcacgggcgacatctggcaggcttcattcacgcctgctattcccgtcagcctgagcttgccgcgaagctgatg gatgttatcgctgaaccctaccgtgaacggttactgccaggcttccggcaggcgcggcaggcggtcgcggaaatcggcgcggtagcgagcggtatctccggctccggcccgaccttg gctctgtgtgacaagccggaaaccgcccagcgcgttgccgactggttgggtaagaactacctgcaaaatcaggaaggttttgttcatatttgccggctggatacggcgggcgcacga ctggaaaactaaatgaaactctacaatctgaaagatcacaacgagcaggtcagctttgcgcaagccgtaacccaggggttgggcaaaaatcaggggctgttttttccgcacgacctg gaattcagcctgactgaaattgatgagatgctgaagctggattttgtcacccgcagtgcgaagatcctctcggcgtttattggtgatgaaatcccacaggaaatcctggaagagcgc gcttatcgtgcgctgcgtgatcagttgaatccaggcgaatatggcttgttcctcggcaccgcgcatccggcgaaatttaaagagagcgtggaagcgattctcggtgaaacgttggat ccaaaagagctggcagaacgtgctgatttacccttgctttcacataatctgcccgccgattttgctgcgttgcgtaaattgatgatgaatcatcagtaaaatctattcattatctca aggccgggtttgcttttatgcagcccggcttttttatgaagaaattatggagaaaaatgacagggaaaaaggagaaattctcaataaatgcggtaacttagagattaggattgcgga taacaaccgccgttctcatcgagtaatctccggatatcgacccataacgggcaatgataaaaggagtaacctgtgaaaaagatgcaatctatcgtactcgcactttccctggttctg gctcccatggcagcacaggctgcggaaattacgttagtcccgtcagtaaaattacagataggcgatcgtgataatcgtggctattactgggatggaggtcactggcgcgaccacggc gctcccatggcagcacaggctgcggaaattacgttagtcccgtcagtaaaattacagataggcgatcgtgataatcgtggctattactgggatggaggtcactggcgcgaccacggc gcttttcattctgactgcaacgggcaatatgtctctgtgtggattaaaaaaagagtgtctgatagcagcttctgaactggttacctgccgtgagtaaattaaaattttattgactta ggtcactaaatactttaaccaatataggcatagcgcacagacagataaaaattacagagtacacaacatccatgaaacgcattagcaccaccattaccaccaccatcaccattacca acggtgcgggctgacgcgtacaggaaacacagaaaaaagcccgcacctgacagtgcgggctttttttttcgaccaaaggtaacgaggtaacaaccatgcgagtgttgaagttcggca Нуклеотидные последовательности (номенклатура, правила записи и чтения) А.Б.Рахманинова, 2006 г.


Слайд 1

Нуклеиновые кислоты - линейные гетерополимеры нуклеотидов Повторяем...


Слайд 2


Слайд 3

Азотистое основание цитозин Нуклеозид цитидин Нуклеотид цитидинмонофосфат (ЦМФ) 1


Слайд 4

9


Слайд 5

Аденозин-5'-монофосфат (АМФ), Аденозин-5'-дифосфат (АДФ), Аденозин-5'-трифосфат (АТФ)


Слайд 6

Номенклатура стандартных азотистых оснований, нуклеозидов и нуклеотидов


Слайд 7

ДНК Повторяем: фосфодиэфирные связи, сахарофосфатный остов, антипараллельные цепи, 3'- и 5'- конец, канонические пары.


Слайд 8

Разработка эффективных методов секвенирования привела к быстрому росту известных последовательностей


Слайд 9

Как записывают последовательности нуклеиновых кислот ? 1. Последовательность = последовательность однобуквенных символов. Никаких дефисов и обозначений фосфодиэфирных связей. 2. Одни и те же однобуквенные символы для последовательностей РНК и ДНК (при записи РНК обычно ‘U’ ? ‘T’ ). Любая последовательность по умолчанию считается ДНК (т.е. полимером 2'-дезоксирибонуклеотидов). 3. Одни и те же символы используются для обозначения азотистых оснований, нуклеозидов и нуклеотидов Допустимы заглавные и строчные буквы, хотя рекомендованы заглавные. 4. Последовательность записывается в направлении 5'>3' Пример: 5'-CTCGAC-3' Nomenclature Committee of the International Union of Biochemistry (NC-IUB) Nomenclature for incompletely specified bases in nucleic acid sequences Recommendations 1984 Biochem. J. (1985) 229, 281-286


Слайд 10

1 ----TGGtACAGCATTTGCA 2 ----TGGCACAGCcTTcGCA 3 ----TGGCAttaGcTTTGCA 4 ----TGGCACgatAgTcGCA 5 ----TGGCACAGGcTgTGCt 6 ----TGGCACAGatTTcGCt 7 ----TGGtACAaGAccTGCA 8 ----TGGCACgattTTTtCA 9 ----TGGCAagcaAaTTGCA 10 ----gGGCgCAGCcTTcGCA 11 ----TGGtAtcGCAaTTGCt 12 ----TGGagCgcGAaTTGCA 13 ----TGGtAtgttcccTGCA CONSENSUS.......TGGCACrrsmtTTGCA


Слайд 11

Общепринятые однобуквенные обозначения для стандартных азотистых оснований (остатков нуклеозидов и нуклеотидов) и вырожденных позиций в выравниваниях нуклеиновых кислот


Слайд 12

~2 500 000 последовательностей компьютерный поиск гена, трансляция и компьютерная аннотация UniRef (UniProt non-redundant Reference databases) UniParc (UniProt Archive) ?200 000 последовательностей Экспертиза Базы данных научной литературы


Слайд 13

The EMBL Nucleotide Sequence Database (также просто БД EMBL)


×

HTML:





Ссылка: