'

Банки информации

Понравилась презентация – покажи это...





Слайд 0

Банки информации в молекулярной биологии С.А.Спирин 11/III – 2006


Слайд 1

Пример информации последовательность ДНК gatcaacactacttgacttcaagacttaccataaagaaaactatagtgtggtattggcaa aagacaagacaaatagatcaacataacaaaataaagggccatgaaatagacccatatagt caattgatttttgacaaagaaggattggcaatagaatggggtaaagatagtcttctcaac aaacggtaccagaatgactgaatacccacatgcaaaaagaaaaagaaatgaacctagaca cagatcttatacagttcacaaaaatgtaactcaaaatgaatcatagacctaaatataata ttcaagactataaaaccctaaaatataacataggggaaaatctaaacaatcttgagtttg ttaatgactttttagatacaataccaaaggcaggatccaggaaagaatcgataagctggg cttcattaaaattaaaatatttctgctctatgaagccactgtcaagagaaggaaaaggca agccatagactgggagaaaatatttacaaaagacatacatgataaaggactattatccaa aatgtacaaagaactctaaaaaacttaacaataagaaaacaaacccaactaaaaactggg ccaaagatcttaacagatatattaccaaagaagatacacagatggcaaataagcataaaa agattaaccacatcatacgtcattaagaaattgcaaattaaaacaacaatgagacaccat tatacacctagtagaatgacccaaatccagattactgacataatcaaatgctgacaagga tgtggagaaacaggaactgccattcttgggttgtgggaatgccaaatggtatgcctgctt tggaagacagcttggtggtttcttacaacactaagcatactcttaccaaaagatcgagca


Слайд 2

Вообще-то ДНК — это молекула... Примеры молекул: Сульфат Фенол Фосфат тиамина (атомы водорода не показаны)


Слайд 3

Молекула ДНК A C G T C N O P


Слайд 4

Одну нить ДНК можно условно обозначить последовательностью букв CGCCATAAATCAC


Слайд 5

Детали строения молекул в микроскоп не видны! ~ 0,00001 мм Существуют сложные и дорогие методы расшифровки структуры молекул


Слайд 6

В конце 1970-х годов был открыт относительно быстрый и дешёвый метод расшифровки последовательности оснований в ДНК Организм ДНК «в пробирке» Последовательность выделение секвенирование ...CGCCATAAATCAC...


Слайд 7

Последовательность ДНК (пример) gatcaacactacttgacttcaagacttaccataaagaaaactatagtgtggtattggcaa aagacaagacaaatagatcaacataacaaaataaagggccatgaaatagacccatatagt caattgatttttgacaaagaaggattggcaatagaatggggtaaagatagtcttctcaac aaacggtaccagaatgactgaatacccacatgcaaaaagaaaaagaaatgaacctagaca cagatcttatacagttcacaaaaatgtaactcaaaatgaatcatagacctaaatataata ttcaagactataaaaccctaaaatataacataggggaaaatctaaacaatcttgagtttg ttaatgactttttagatacaataccaaaggcaggatccaggaaagaatcgataagctggg cttcattaaaattaaaatatttctgctctatgaagccactgtcaagagaaggaaaaggca agccatagactgggagaaaatatttacaaaagacatacatgataaaggactattatccaa aatgtacaaagaactctaaaaaacttaacaataagaaaacaaacccaactaaaaactggg ccaaagatcttaacagatatattaccaaagaagatacacagatggcaaataagcataaaa agattaaccacatcatacgtcattaagaaattgcaaattaaaacaacaatgagacaccat tatacacctagtagaatgacccaaatccagattactgacataatcaaatgctgacaagga tgtggagaaacaggaactgccattcttgggttgtgggaatgccaaatggtatgcctgctt tggaagacagcttggtggtttcttacaacactaagcatactcttaccaaaagatcgagca


Слайд 8

Для хранения все возрастающей информации о последовательностях ДНК в 1982 году был основан GenBank GenBank — хранилище последовательностей нуклеиновых кислот в виде компьютерных файлов Объем GenBank’а: 1982: 680 338 букв в 606 последовательностях 1992: 101 008 486 букв в 78 608 последовательностях 2002: 28 507 990 166 букв в 22 318 883 последовательностях 2004: 44 575 745 176 букв в 40 604 319 последовательностях 2005: 56 037 734 462 букв в 52 016 762 последовательностях (из ~165 000 организмов) Размер файлов — 196 Gb


Слайд 9

International Nucleotide Sequence Database Collaboration GenBank (США) EMBL (Европа) DDBJ (Япония) Ежедневный обмен данными


Слайд 10

Структура документа GenBank’а Описание Последовательность


Слайд 11

GenBank — архивная база данных Один эксперимент — один документ Зачем в документе GenBank’а описательная часть? Ответы: 1) чтобы пользователь банка мог найти интересующую его последовательность; 2) для хранения дополнительной информации (откуда ДНК, кто проводил эксперимент по секвенированию, биологическая роль данной последовательности и т.д.)


Слайд 12

Основная проблема больших банков данных — быстрый поиск нужной информации Для удобства пользования описательная часть документа GenBank разбита на так называемые поля (“fields”) Общий принцип: любая база данных состоит, с одной стороны, из записей (или «документов»), а с другой стороны, из полей. Каждая запись есть наполнение содержанием нескольких (или всех) полей.


Слайд 13

Основная проблема больших банков данных — быстрый поиск нужной информации Как найти интересующую нас последовательность в GenBank’е? Существуют специальные компьютерные программы (например, SRS или Entrez), предназначенные для поиска по ключевым словам в банках последовательностей. Пользователь указывает программе, по каким полям нужно искать и какое слово (или слова). Программа выдаёт список записей банка, в которых указанные слова встретились в указанных полях.


Слайд 14

Примеры задания на поиск “gene” в поле DEFINITION “yeast” в поле ORGANISM “Ivanov” в поле AUTHORS “yeast” в поле ORGANISM И “tRNA” в поле DEFINITION “mouse” ИЛИ “rat” в поле ORGANISM


Слайд 15

Как искать? Перебрать все 52 млн. записей, и в каждой посмотреть, есть ли в соответствующем поле заданное слово. Заранее создать индексную таблицу каждого из полей и при каждом запросе обращаться к ней Это долго даже современному компьютеру!


Слайд 16

Мораль: при создании программ для работы с биологическими базами данных необходимо использовать достижения теории алгоритмов


Слайд 17

Что такое биоинформатика? Исследование информационных процессов в биологических системах (клетках, органах, организме, популяции). Изучение и внедрение в компьютерную науку «биологических» методов анализа информации (нейросетей, генетических алгоритмов, нечеткой логики и др.). Применение компьютерных методов для решения биологических задач. Телепатия, парапсихология, информационные поля и т.п. ?


Слайд 18

Что такое биоинформатика? Исследование информационных процессов в биологических системах (клетках, органах, организме, популяции). Изучение и внедрение в компьютерную науку «биологических» методов анализа информации (нейросетей, генетических алгоритмов, нечеткой логики и др.). Применение компьютерных методов для решения биологических задач. Телепатия, парапсихология, информационные поля и т.п.


Слайд 19

Биоинформатика и её связи с другими дисциплинами Биоинформатика (компьютерная молекулярная биология) Молекулярная биология Информатика (в том числе теория алгоритмов) Теория вероятностей и математическая статистика


Слайд 20

Основные объекты современной биоинформатики Последовательности нуклеиновых кислот Последовательности белков Пространственные структуры макромолекул (белков, ДНК и РНК) и их комплексов (друг с другом и с малыми молекулами)


Слайд 21

Что такое белок Пространственная структура RRNFSKQASE ILNEYFYSHL SNPYPSEEAK EELARKCGIT VSQVSNWFGN KRIRYKKNI Последовательность


Слайд 22

Банки структурной биологической информации GenBank, EMBL, DDBJ RefSeq Архивные базы последовательностей нуклеиновых кислот Автоматическая база различных последовательностей НК SwissProt Курируемая база последовательностей белков PDB Архивная база пространственных структур макромолекул И многие другие...


×

HTML:





Ссылка: